What are the important design features of PCR primers used to generate linear DNA template for TnT® coupled in vitro transcription/translation systems?
Unless the target sequence being amplified contains a termination codon (TAA, TGA or TAG), it is necessary to include one of these codon sequences in the downstream primer. This facilitates efficient termination and generation of protein product of the correct size as well as recycling of the ribosomal subunits for additional rounds of translation. As with the upstream primer, it must have sufficient target sequence to anneal correctly to the template DNA (~18 bases).
It is best for both primers to be of similar length and %GC content (if possible) in order that they will possess similar annealing temperatures. The easiest way to increase the size of the downstream primer is to use more target sequence at the 3´-end (e.g., 48 bases instead of 18). There are multiple ways to calculate theoretical annealing temperatures (e.g., melting temperature, Tm) of oligonucleotide primers.
One equation considers the concentration of monovalent cations, %GC content and length of the oligo:
Tm = 81.5°C + 16.6°C × (log10[[Na+]+[K+]]) + 0.41°C × (%GC) – 675/N
...where N = number of nucleotides in the primer. Note that PCR is typically conducted in monovalent cation concentration of ~50m.
For example, the Promega T7 Promoter Primer (TAATACGACTCACTATAGGG) has 5-Ts, 7-As, 4-Cs and 4-Gs (20mer, 40% GC). Thus, its melting temperature using the equation above is:
81.5°C + 16.6°C x (log10[0.05]) + 0.41°C × (%GC) – 675/20 = 42.5°C
Once the Tm for each primer is known, 5°C below the lowest Tm is a good starting point for the annealing step in PCR. If you see multiple products, try increasing the Tm by 1°C increments until the nonspecific products disappear.
Related Products
Related Protocols
Related Articles
Products may be covered by pending or issued patents or may have certain limitations on use. Please visit our patent and trademark web page for more information.
