Attention US and Canada Customers

Attention: Due to our annual physical inventory, orders received after 4PM CST on Tuesday, March 11th will be shipped according to the following schedule:
US Orders: Shipped on Saturday, March 15th with an expected arrival on Monday, March 17th.
Canada Orders: Shipped on Monday, March 17th with an expected arrival on Tuesday, March 18th.
We apologize for any inconvenience this may cause.
For any questions, please contact Customer Service at 1-800-356-9526.

pUC/M13 Sequencing Primers

Q5401_pUC-3aM13-Primer--Reverse--17mer---2ug_3
customize-this-small
View information on global supply logistics

Designed for Sequencing Inserts Cloned into the M13 Vectors and pUC Plasmids

  • Sequence other lacZ-containing plasmids such as the pGEM®-Z and pGEM®-Zf Vectors
  • Supplied at a concentration of 10μg/ml
  • pUC/M13 Primer, Forward (17mer; Cat.# Q5391), is no longer available
  • pUC/M13 Primer, Reverse (22mer; Cat.# Q5421), is no longer available

Choose a primer length and direction

Size

Catalog number selected: Q5401

$ 110.00
Your price:
Add to Cart
This product is discontinued
Add to Helix
This product is available under our Early Access program - Learn More
This product is available under our Catalog (FT) program - Learn More
pUC/M13 Sequencing Primers
Reverse 17mer/2µg
$ 110.00
Your price: Log in
Change Configuration

The pUC/M13 Primers are used to sequence inserts cloned into the M13 vectors and pUC plasmids developed by Messing. The primers are purified by gel electrophoresis or HPLC and supplied in sterile water.

Primer Sequences

  • Reverse (17mer): 5´-d(CAGGAAACAGCTATGAC)-3´
  • Forward (24mer): 5´-d(CGCCAGGGTTTTCCCAGTCACGAC)-3´

Reference

  1. Messing, J. (1983) Meth. Enzymol. 101, 20–78.

Specifications

You are viewing: Q5401 Change Configuration

What's in the box?

Item Part # Size

pUC/M13 Primer, Reverse (17mer)

Q540A 1 × 2μg

Certificate of Analysis

Search by lot number

Use Restrictions

For Research Use Only. Not for Use in Diagnostic Procedures.

Storage Conditions

BB

Specifications

You are viewing: Q5601 Change Configuration

What's in the box?

Item Part # Size

pUC/M13 Primer, Forward (24mer)

Q560A 1 × 2μg

Certificate of Analysis

Search by lot number

Use Restrictions

For Research Use Only. Not for Use in Diagnostic Procedures.

Storage Conditions

BB

Let's find the product that meets your needs.

Talk to a Scientist

scientist-uk-stephen

Stephen

UK