Purification of Bacterial DNA from Food Samples using the Maxwell RSC PureFood Pathogen Kit
Promega Corporation
Publication Date: 06/18
Abstract
Food samples were spiked with bacteria and enriched by culturing with the appropriate enrichment media. The Maxwell® RSC PureFood Pathogen Kit was used to detect low levels of bacterial contamination.
Table 1: Samples were spiked with the indicated bacteria
| E. coli | S. enterica | L. monocytogenes |
|---|---|---|
| Strawberries | Roast Beef Cold Cut Meat | Soft Cheese |
| Cilantro | Raw Frozen Shrimp | Canned Chicken |
Materials:
• EZ-CFU Reference Culture - Listeria monocytogenes (ATCC 19115; Microbiologics, Cat.# 0687Z)
• EZ-CFU Reference Culture - Salmonella enterica (ATCC 13311; Microbiologics, Cat.# 0421C)
• EZ-CFU Reference Culture - Escherichia coli (ATCC 35150 (STEC); Microbiologics, Cat.# 06117E3)
• Canned chicken
• Soft Mexican cheese
• Raw shrimp
• Sliced roast beef deli meat
• Strawberries
• Cilantro
• Seward Stomacher® 400 Circulator
• Stomacher Blender Bags (Fisher Scientific, Cat.# 14258204)
• Ready-to-use Half Fraser Media (Bio-Rad, Cat.# 3555797)
• Buffered Peptone Water (Bio-Rad, Cat.# 3554179)
• 37°C Incubator
• LB Plates (LSS)
• Tryptic Soy Agar (TSA) Plates (LSS)
• Maxwell® PureFood GMO and Authentication Kit (Cat.# AS1600)
• Lysis Buffer (Cat.# A8261)
• Lysis Buffer A
• GoTaq® Probe qPCR Master Mix (Cat.# A6101)
• Listeria monocytogenes serotype 1/2b DNA (Zeptometrix, Cat.# 0801534DNA-10µg)
• Salmonella enterica Typhimurium Z005 DNA (Zeptometrix, Cat.# 0801437DNA-10µg)
• Escherichia coli 0157:H7; EDL933 DNA (Zeptometrix, Cat.# 0801622DNA-10µg)
• QuantiFluor® ONE dsDNA System (Cat.# E4871)
Listeria Primers (IDT):
• ListeriahlyProbe — 5'-/56-FAM/CGCCTGCAA/ZEN/GTCCTAAGACGCCA/3IABkFQ/-3'
• listeriahlyF — 5'-CTCACCAGGAGATTACAACATGG-3'
• listeriahlyR — 5'-ATCCGCGTGTTTCTTTTCGA-3'
Salmonella Primers (IDT):
• SalmonellattrProbe — 5'-/56-FAM/CACCGACGG/ZEN/CGAGACCGACTTT/3IABkFQ/-3'
• SalmonellattrF — 5'-CTCACCAGGAGATTACAACATGG-3'
• SalmonellattrR — 5'-AGCTCAGACCAAAAGTGACCATC-3'
E. coli Primers (IDT):
• ecoliO157stx1Probe — 5'-/6-FAM/CTGGATGAT/ZEN/CTCAGTGGGCGTTCTTATGAA/3IABkFQ/-3'
• ecoliO157stx1F — 5'-TTTGTYACTGTSACAGCWGAAGCYTTACG-3'
• ecoliO157stx1R — 5'-CCCCAGTTCARWGTRAGRTCMACRTC-3'
Methods:
Inoculation of Food Samples with E. coli:
1. Prepared the E. coli suspension.
• Each of the bacterial discs contained 9.4×10^3 CFU.
• Added 3.9ml of the hydrating dilution fluid to 1 pellet (concentration = ~2500CFU/ml)
2. 25g of strawberries or cilantro was weighed into a Stomacher® bag containing 225ml of Peptone Buffered Water (PBW). [4 bags/sample type]
3. Bags were inoculated with ~0, 5, 10 or 50 CFU/g of the E. coli suspension, as shown in Table 2.
4. Additionally, 50 and 100µl of the suspension was plated on LB plates to determine accurate CFU counts.
5. Samples were incubated at 37°C for approximately 20 hours.
Table 2: Inoculation of samples with E. coli
| CFU/g | Total CFU | Volume E. coli Suspension Added (µl) |
|---|---|---|
| 0 | 0 | 0 |
| 5 | 125 | 50 |
| 10 | 250 | 100 |
| 50 | 1250 | 500 |
Inoculation of Food Samples with S. enterica:
1. Prepared the S. enterica suspension.
• Each of the bacterial discs contained 6.8×10^3 CFU.
• Added 2.7ml of the hydrating dilution fluid to 1 pellet (concentration = ~2500CFU/ml)
2. 25g of shrimp or deli meat was weighed into the Stomacher® bag containing 225ml of PBW. [4 bags/sample type]
3. Bags were inoculated with ~0, 5, 10 or 50 CFU/g of the S. enterica suspension, as shown in Table 3.
4. Additionally, 50 and 100µl of the suspension was plated on LB plates to determine accurate CFU counts.
5. Samples were incubated at 37°C for approximately 20 hours.
Table 3: Inoculation of samples with S. enterica
| CFU/g | Total CFU | Volume S. enterica Suspension Added (µl) |
|---|---|---|
| 0 | 0 | 0 |
| 5 | 125 | 50 |
| 10 | 250 | 100 |
| 50 | 1250 | 500 |
Inoculation of Food Samples with L. monocytogenes:
1. Prepared the L. monocytogenes suspension.
• Each of the bacterial discs contained 5.3×10^2 CFU.
• Added 1.7ml of the hydrating dilution fluid to 4 pellets (concentration = ~1250CFU/ml)
2. 25g of canned meat or soft cheese was weighed into the Stomacher® bags containing 225ml of half Fraser Broth [4 bags/sample type]
3. Bags were inoculated with ~0, 5, 10 or 50 CFU/g of the L. monocytogenes suspension, as shown in Table 4.
4. Additionally, 50µl of the suspension was plated on TSA plates to determine accurate CFU counts.
5. Samples were incubated at 37°C for approximately 20 hours.
Table 4: Inoculation of samples with L. monocytogenes
| CFU/g | Total CFU | Volume L. monocytogenes Suspension Added (µl) |
|---|---|---|
| 0 | 0 | 0 |
| 5 | 125 | 100 |
| 10 | 250 | 200 |
| 20 | 500 | 500 |
DNA Purification from all Sample Types:
1. 800µl of the enriched sample was transferred to a 1.5ml tube.
2. 200µl of Lysis Buffer A was added and the sample was spun in a vortex at 56°C for 4 minutes.
3. 300µl of Lysis Buffer (Cat.# A8261). The sample was spun in a vortex for 10 seconds.
4. The entire volume of lysate was transferred to well #1 of the Maxwell® RSC PureFood GMO and Authentication Kit Cartridge.
5. The sample was processed in the Maxwell® RSC Instrument using the RSC Blood DNA method.
6. Most samples contained a white/tan precipitate. All samples were spun at maximum speed in a microcentrifuge for two minutes. Eluates were transferred to clean tubes, avoiding the transfer of any of the pelleted precipitate.
DNA Concentration by QuantiFluor® ONE dsDNA System:
DNA was quantified using the method prescribed in the technical manual, TM405. Total fluorescence was measured on the Quantus™ Instrument, which had been calibrated with the Lambda DNA standard provided in the kit.
qPCR with Species-Specific Primers:
1. A 20X primer and probe mix was prepared (18µM forward and reverse primers and 5µM probe).
2. The reaction mixture was prepared according to Table 5. For reactions amplified on the ABI 7500, CXR passive-reference dye was added to a final concentration of 30nM.
3. Standard curves were prepared using the appropriate reference standard. Seven 5X serial dilutions were prepared with each bacterial standard using nuclease-free water as the diluent. The highest concentration point on the standard curves were 5ng/µl, 25ng/µl and 25ng/µl for L. monocytogenes, E. coli and S. enterica, respectively.
4. 2µl of the eluate or standard was added to 18µl of the reaction mixture. Analysis with the QuantiFluor® ONE dsDNA system indicated a need to dilute eluates for the S. enterica (shrimp and sliced roast beef) and E. coli (cilantro and strawberry) samples prior to amplification. Eluates were diluted 1:10 to bring them into an acceptable range for qPCR assay (<100ng total DNA added/reaction).
5. The reactions were amplified either on the ABI7500 qPCR Instrument (S. enterica) or on the Bio-Rad CFX qPCR Instrument (E. coli and L. monocytogenes).
Table 5: Amplification Reaction Setup
| Component | Volume/Reaction |
|---|---|
| GoTaq® Probe qPCR Master Mix, dTTP (2X) | 10µl |
| 20X Primer/Probe Mix, Final Concentration = 900nM F and R primers, 250nM Probe | 1µl |
| Nuclease-free Water | 7µl |
| Sample | 2µl |
| Total | 20µl |
Results:
DNA was extracted from 800µl of enriched cultures containing food samples using the new Maxwell® RSC PureFood Pathogen chemistry. For each extraction, total DNA concentration was determined using the QuantiFluor® ONE dsDNA System, and the concentration of the spiked bacterium was determined using species-specific bacterial primers and probes. For E. coli 0157:H7, we were able to detect the E. coli 0157:H7 DNA in all spiked samples of cilantro and strawberries (Figures 1 and 2). The required sensitivity was <100 CFU/gram of sample and we were able to detect E. coli DNA at even the lowest bacterial count tested, which was 4.1 CFU/gram starting concentration prior to enrichment. For S. enterica, we were able to detect the S. enterica DNA in all spiked samples of shrimp and roast beef cold cut meat (Figures 3 and 4). The required sensitivity was <10 CFU/gram of sample and we were able to detect S. enterica at even the lowest bacterial count tested, which was 7.7 CFU/gram starting concentration prior to enrichment. Finally, for L. monocytogenes, we were able to detect the L. monocytogenes DNA in all spiked samples of soft cheese and canned chicken (Figures 5 and 6). The required sensitivity was <100 CFU/gram of sample, and we were able to detect L. monocytogenes DNA at even the lowest bacterial count tested, which was 1.7 CFU/gram starting concentration prior to enrichment.
Figure 1. Comparison of total DNA and E. coli 0157:H7 DNA extracted from cilantro samples spiked with the indicated amount of E. coli 0157:H7 bacteria. Samples were spiked with the indicated number of bacteria (colony forming units/gram). Samples were enriched by culturing in peptone buffered water (PBW) for 20 hours at 37°C. DNA was extracted from 800µl of sample (four replicates/condition). The total DNA concentration in the eluates was assessed using the QuantiFluor® ONE dsDNA System (Panel A), and the concentration of E. coli 0157:H7 DNA was assessed with specific primers (Panel B). Error bars represent the standard deviation for quadruplicate purifications.
Figure 2. Comparison of total DNA and E. coli 0157:H7 DNA extracted from strawberry samples spiked with the indicated amount of E. coli 0157:H7 bacteria. Samples were spiked with the indicated number of bacteria (colony forming units/gram). Samples were enriched by culturing in peptone buffered water (PBW) for 20 hours at 37°C. DNA was extracted from 800µl of sample (four replicates/condition). The total DNA concentration in the eluates was assessed using the QuantiFluor® ONE dsDNA System (Panel A), and the concentration of E. coli 0157:H7 DNA was assessed with specific primers (Panel B). Error bars represent the standard deviation for quadruplicate purifications.
Figure 3. Comparison of total DNA and S. enterica DNA extracted from raw shrimp samples spiked with the indicated amounts of S. enterica bacteria. Samples were spiked with the indicated number of bacteria (colony forming units/gram). Samples were enriched by culturing in peptone buffered water (PBW) for 20 hours at 37°C. DNA was extracted from 800µl of sample (four replicates/condition). The total DNA concentration in the eluates was assessed using the QuantiFluor® ONE dsDNA System (Panel A), and the concentration of S. enterica DNA was assessed with specific primers (Panel B). Error bars represent the standard deviation for quadruplicate purifications.
Figure 4. Comparison of total DNA and S. enterica DNA extracted from roast beef cold cut meat samples spiked with the indicated amounts of S. enterica bacteria. Samples were spiked with the indicated number of bacteria (colony forming units/gram). Samples were enriched by culturing in peptone buffered water (PBW) for 20 hours at 37°C. DNA was extracted from 800µl of sample (four replicates/condition). The total DNA concentration in the eluates was assessed using the QuantiFluor® ONE dsDNA System (Panel A), and the concentration of S. enterica DNA was assessed with specific primers (Panel B). Error bars represent the standard deviation for quadruplicate purifications.
Figure 5. Comparison of total DNA and L. monocytogenes DNA extracted from soft cheese samples spiked with the indicated amounts of L. monocytogenes bacteria. Samples were spiked with the indicated number of bacteria (colony forming units/gram). Samples were enriched by culturing in Half Fraser Broth for 20 hours at 37°C. DNA was extracted from 800µl of sample (four replicates/condition). The total DNA concentration in the eluates was assessed using the QuantiFluor® ONE dsDNA System (Panel A), and the concentration of L. monocytogenes DNA was assessed with specific primers (Panel B). Error bars represent the standard deviation for quadruplicate purifications.
Figure 6. Comparison of total DNA and L. monocytogenes DNA extracted from canned chicken samples spiked with the indicated amounts of L. monocytogenes bacteria. Samples were spiked with the indicated number of bacteria (colony forming units/gram). Samples were enriched by culturing in Half Fraser Broth for 20 hours at 37°C. DNA was extracted from 800µl of sample (four replicates/condition). The total DNA concentration in the eluates was assessed using the QuantiFluor® ONE dsDNA System (Panel A), and the concentration of L. monocytogenes DNA was assessed with specific primers (Panel B). Error bars represent the standard deviation for quadruplicate purifications.
Conclusions: We were able to detect low levels of bacterial contamination in food samples spiked with bacteria and enriched by culturing with the appropriate enrichment media. E. coli spiked into cilantro and strawberry samples was detected at a concentration as low as 4.1 CFU/gram in the pre-enriched food culture. S. enterica spiked into roast beef cold cut meat and raw shrimp samples was detected at a concentration as low as 7.7 CFU/gram in the re-enriched food culture. L. monocytogenes spiked into soft cheese and canned chicken samples was detected at a concentration as low as 1.7 CFU/gram in the pre-enriched food culture.
